05 Dec 2011, 6:54 pm
The ASPERGERS sequence:
GATGCTTGCAAGAGGAGAAAGTCCTGAACGGTAG
The SYNDROME sequence:
GATGGATGAGGTAAATAGACAGTAATATTCTGTATAGTT
I wonder if there is a connection between Fibromyalgia(FMS) and Interstitial Cystitis(IC) and Aspergers Syndrome? My mother, has Fibromyalgia and we also believe that she has Aspergers. I have Fibromyalgia and Interstitial Cystitis with the Hunner ulceration in the Interstitial lining (Hunner Syndrome) and Aspergers Syndrome. My son has Interstitial Cystitis and Aspergers Syndrome. I asked this question to my new pain physician at the Eastern Virginia Medical School and he found it interesting and checked to see if there was research done on it but there hasn't been any done to see if there is a connection. I've seen others ask the same question.
I've been told that FMS and IC are on the same genetic marker.
It's just so annoying to cough like this.
The signature sequence is not literal. No protein encoding for (M)ASPERGERS, (M)LARGESPER, (M)DEVNRQ(O)YSV or (M)SYNDR(O)ME would have significant effects without being toxic. I just posted those sequences because they can form anagrams of themselves when reversed (especially with (M)ASPERGERS->(M)LARGESPER.
I'd like to thank the entertainment for this evening. Special interests are special for a reason, and those facts just gave me something to research.
It does mean I will be unavailable for a few hours as I check the NCBI's site.
(If you have any interesting bits of information relating to genetics, please don't tell me about them until Thursday or Friday because they do have near-maximal distraction potential, and I would like to receive higher grades this semester. Until I upload my research to my site, it would be nice if there was some restraint in posting interesting things related to biochemistry.)
CockneyRebel
Veteran
Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,205
Location: In my own little country
05 Dec 2011, 6:59 pm
I think that special interests are a good thing.
05 Dec 2011, 7:04 pm
05 Dec 2011, 7:06 pm
They're good for having fun, relaxing, and mental stimulation, but they do take a lot away from my schoolwork and college efforts.
MXH
Veteran
Joined: 28 Jul 2010
Age: 35
Gender: Male
Posts: 13,057
Location: Here i stand and face the rain
05 Dec 2011, 7:07 pm
05 Dec 2011, 7:07 pm
iamnotaparakeet
Veteran
Joined: 31 Jul 2007
Age: 40
Gender: Male
Posts: 25,091
Location: 0.5 Galactic radius
05 Dec 2011, 9:06 pm
MakaylaTheAspie
Veteran
Joined: 21 Jun 2011
Age: 30
Gender: Non-binary
Posts: 14,565
Location: O'er the land of the so-called free and the home of the self-proclaimed brave. (Oregon)
05 Dec 2011, 10:36 pm
MXH
Veteran
Joined: 28 Jul 2010
Age: 35
Gender: Male
Posts: 13,057
Location: Here i stand and face the rain
05 Dec 2011, 10:48 pm
CockneyRebel
Veteran
Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,205
Location: In my own little country
05 Dec 2011, 11:45 pm
I just got back from a Christmas dinner with my friends. It was very fun.
05 Dec 2011, 11:54 pm
A Christmas dinner three weeks early? At least there is plenty of holiday cheer.
CockneyRebel
Veteran
Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,205
Location: In my own little country
06 Dec 2011, 12:20 am
A Christmas dinner three weeks early? At least there is plenty of holiday cheer.
It was wonderful. I've enjoyed myself.
06 Dec 2011, 1:07 am
Wow... Mick, that's nice!
I will be having my share, as this Saturday, my friends will be having our own party. At the coffee house, though; we'll be reserving an entire spot.
06 Dec 2011, 1:23 am
rabbitears
Veteran
Joined: 18 Jan 2011
Age: 34
Gender: Female
Posts: 6,398
Location: In a box of chocolate milk mix.
06 Dec 2011, 2:29 am
Seriously not looking forward to going to work today. 
_________________
THINGS I LIKE
Parasaurolophus, Plesiosaurs, Dinosaurs, Pterosaurs, Music, Tuna, Chocolate milk, Oreos, Blue things
Parasaurolophuscolobus. Parasaurcolobus. Colobusaurolophus.
....And Nunchucks are my friends.
CockneyRebel
Veteran
Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,205
Location: In my own little country
06 Dec 2011, 4:39 am
