Interesting piece on autism, genetics, and RNA

Page 1 of 1 [ 11 posts ] 


Does the article make sense to you?
Yeah, it definitely does. 27%  27%  [ 3 ]
Not sure, but it sounds interesting. 9%  9%  [ 1 ]
No, I have other ideas about autism genetics. 9%  9%  [ 1 ]
Meh, I don't care, but thanks for the read anyways! 9%  9%  [ 1 ]
***mutant crickets*** 36%  36%  [ 4 ]
***tumbleweed*** 9%  9%  [ 1 ]
Total votes : 11

Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

13 Dec 2012, 10:53 am

Hi, everyone. Thought I'd share this interesting piece focusing on some of the new findings of the ENCODE consortium regarding RNA and how that may relate to autism:

Move Over, Proteins - Science Says it's an RNA World Now. But Is It?

So what are your thoughts on the genetics of autism?


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

14 Dec 2012, 9:27 am

On a related note, a small biotech company has developed a better microarray technique to gauge even smaller copy number variants (CNVs) in autism. Up until now, the technology really was only capable of detecting large CNVs.

http://www.bio-itworld.com/2012/12/13/p ... -cnvs.html

For those who don't know what a CNV is, the genome is loaded with repetitious elements. Sometimes these are huge, involving more than a 1000 base pairs; sometimes they're as small as three nucleotides. CNV refers to repeat elements which occur consecutively, like CAGCAGCAGCAG. In the case of autism, there are increased occurrences of CNVs, either in the form of more duplications of a particular element, e.g., CAGCAGCAGCAGCAGCAGCAGCAG, or deletions of a typical repeat, e.g., CAGCAG.

These repeats are often sites for enhanced genome instability and that instability seems to lead to further changes in CNV. The CAG and CTG repeats of Fragile X are an excellent example. This site is a known "fragile site"-- meaning it's even more prone to breakages than most sites-- and the syndrome is defined by 200+ CAG/CTG repeats. Carriers of ~55-<200 repeats do have unstable genomes within the Fragile X site, but they don't seem to have any obvious manifestations other than the fact that they are more prone to having children with the full syndrome. Within the fullblown syndrome, when there are so many CAG/CTG repeats, these areas can be targeted by methylation, which often targets C and G rich areas (CAG/CTG) and are known as CpG islands. Anywho, the hypermethylation prevents transcription of the local gene, such that the product, FMRP, has reduced or deleted transcription (i.e., DNA > RNA product).

Cool stuff, huh? :)


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


OddDuckNash99
Veteran
Veteran

User avatar

Joined: 15 Nov 2006
Gender: Female
Posts: 2,562

14 Dec 2012, 9:58 am

I think the title of the article is dumb. Proteins are translated through mRNA, so malformed and absent proteins always have been caused by mutations/mistakes in RNA. They should have said something like, "Move over, proteins and mRNA- it's a microRNA world." :roll:

As for my thoughts on the genetics, I really don't have all that solid of an opinion. Whatever the genetic/chromosomal cause, it is likely to be extremely complex and may never be able to be completely explained. I'm a big proponent of the testosterone hypothesis, but that's about it.


_________________
Helinger: Now, what do you see, John?
Nash: Recognition...
Helinger: Well, try seeing accomplishment!
Nash: Is there a difference?


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

14 Dec 2012, 10:03 am

There are more types of RNA than just micro, however. It was just meant to be general, in the sense that scientists have perpetually focused on proteins as the end-all-be-all product of the genome. So it's really worded to reflect a change in focus methinks.


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


OddDuckNash99
Veteran
Veteran

User avatar

Joined: 15 Nov 2006
Gender: Female
Posts: 2,562

14 Dec 2012, 10:18 am

Sophist wrote:
It was just meant to be general, in the sense that scientists have perpetually focused on proteins as the end-all-be-all product of the genome.

Yes, probably, but no matter where the problem is in the genome (gene regulation, mRNA mutation, epigenetic factors like methylation, transposons, etc.), the end result is going to affect protein function and production in some way. I realize I'm being pedantic about it, but I just feel that the way the title is worded may confuse non-scientists who are reading the article.


_________________
Helinger: Now, what do you see, John?
Nash: Recognition...
Helinger: Well, try seeing accomplishment!
Nash: Is there a difference?


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

14 Dec 2012, 10:55 am

OddDuckNash99 wrote:
Sophist wrote:
It was just meant to be general, in the sense that scientists have perpetually focused on proteins as the end-all-be-all product of the genome.

Yes, probably, but no matter where the problem is in the genome (gene regulation, mRNA mutation, epigenetic factors like methylation, transposons, etc.), the end result is going to affect protein function and production in some way. I realize I'm being pedantic about it, but I just feel that the way the title is worded may confuse non-scientists who are reading the article.


Point understood. :)


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


OddDuckNash99
Veteran
Veteran

User avatar

Joined: 15 Nov 2006
Gender: Female
Posts: 2,562

14 Dec 2012, 11:49 am

Sophist wrote:
Point understood. :)

I figured the "Professor of Pedantry" would see my pedantic point. :lol:


_________________
Helinger: Now, what do you see, John?
Nash: Recognition...
Helinger: Well, try seeing accomplishment!
Nash: Is there a difference?


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

14 Dec 2012, 12:34 pm

OddDuckNash99 wrote:
Sophist wrote:
Point understood. :)

I figured the "Professor of Pedantry" would see my pedantic point. :lol:


Am definitely a connoisseur of pedantry. Much appreciated. :lol:


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

14 Dec 2012, 12:35 pm

As an aside, so far "mutant crickets" appears to be winning the poll. :wtg:


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/


Ca2MgFe5Si8O22OH2
Deinonychus
Deinonychus

User avatar

Joined: 14 Aug 2012
Age: 38
Gender: Female
Posts: 300
Location: Little Rock, AR

14 Dec 2012, 6:40 pm

god I need to brush up my biochem and genetics. everything comes down to orgo, doesn't it?


_________________
KADI score: 114/130
Your Aspie score: 139 of 200
Your neurotypical (non-autistic) score: 54 of 200
Conversion Disorder, General/Social Anxiety Disorder, Major Depression


Sophist
Veteran
Veteran

User avatar

Joined: 23 Apr 2005
Age: 44
Gender: Female
Posts: 6,332
Location: Louisville, KY

16 Dec 2012, 1:57 pm

Ca2MgFe5Si8O22OH2 wrote:
god I need to brush up my biochem and genetics. everything comes down to orgo, doesn't it?


Alas, yes. I'm brushing up my organic too-- along with biochem and gen.

Btw, here's a new post along a similar lines from the blog: http://insolemexumbra.wordpress.com/201 ... -treasure/


_________________
My Science blog, Science Over a Cuppa - http://insolemexumbra.wordpress.com/

My partner's autism science blog, Cortical Chauvinism - http://corticalchauvinism.wordpress.com/