Increased Risk For Autism When Genetic Variation And Air Pol
https://scienceblog.com/494807/increase ... tion-meet/
A new analysis shows that individuals with high levels of genetic variation and elevated exposure to ozone in the environment are at an even higher risk for developing autism than would be expected by adding the two risk factors together. The study is the first to look at the combined effects of genome-wide genetic change and environmental risk factors for autism, and the first to identify an interaction between genes and environment that leads to an emergent increase in risk that would not be found by studying these factors independently.
A paper describing the research appears online in the journal Autism Research.
“Autism, like most human diseases, is complex,” said Scott B. Selleck, professor of biochemistry and molecular biology at Penn State and one of the leaders of the research team. “There are probably hundreds, if not thousands, of genes involved and up until now — with very few exceptions — these have been studied independently of the environmental contributors to autism, which are real. Our team of researchers represents a merger of people with genetic expertise and environmental epidemiologists, allowing us for the first time to answer questions about how genetic and environmental risk factors for autism interact.”
Whole populations of people can vary in their degree of "genetic variation", but how can one person have 'genetic variation'? How can you "vary" from yourself?
They probably mean copy number variations (cnv's) or mutations that alter the protein so that it doesn't code for the protein that it's supposed to code for.
Most mutations are pathogenic or don't cause too much harm, or rarely, by chance, have a benefit that drives evolution.
The 1'st and forth one here are frameshift copy number variations:
MECP2 rs63749064 153295990 — or GGGCAGCCGTCGCTCTCCAGTGAGC
GGGCAGCCGTCGCTCTCCAGTGAGC / GGGCAGCCGTCGCTCTCCAGTGAGC
MECP2 rs61753971 153295997 C or T C / C
MECP2 rs61753970 153296013 A or G G / G
MECP2 i5900852 153296019 — or TCTGGGCATCTTCTCCTCTTTGCAGA — / —
I actually have 55 frameshifts on this gene and the snp's between them have pathogenic mutations because the frameshift mutations mess up the whole gene.
And 21 frameshift cnv's on cdkl5.
But these are on the x chromosome and I have 2 x chromosomes because I'm female and so my cells may be skewed toward selecting the unaffected copy rather then randomly selecting.
but I have recurrent frameshift cnv's on other chromosomes that also are supposed to cause rett or mental retardation or joubert syndrome or other things that are fatal.
but I don't have any of those diseases.
Maybe copy number variations don't cause too much harm, just a few autism symptoms.
I wonder if being born near Laguardia airport in the late 1940's (post world war II) to a mother who smoked through her pregnancies had an affect on my genes.
There is so much we don't understand about human genetics, evolution, and the role environmental epigenetics play. This topic fascinates me.
| Similar Topics | |
|---|---|
| Autism influencers on IG, X, TikTok, etc. |
Yesterday, 10:57 am |
